After all, the last thing anyone wants is to get bunk seeds. In three female strains Moby Dick, Space Queen and Copenhagen Kush- primers S22645strt 5 CCAATAACCCTCATCCCATTCC3 and S22645end 5 ATTTCCAAAAGTGTGCGATTCC3 were used to amplify beyond the region of the female 540 bp band. In addition, dense weed stands for example, a sod of smooth crabgrass or other grass weed seedlings can interfere with the efficacy of cultivation implements in severing or uprooting weeds Mohler, 2001b. Source:
http://www.chockstone.org/Forum/Forum.asp?Action=Profile&UserName=pidorok3 [pr]
